/*===========================================================================
*
*                            PUBLIC DOMAIN NOTICE
*               National Center for Biotechnology Information
*
*  This software/database is a "United States Government Work" under the
*  terms of the United States Copyright Act.  It was written as part of
*  the author's official duties as a United States Government employee and
*  thus cannot be copyrighted.  This software/database is freely available
*  to the public for use. The National Library of Medicine and the U.S.
*  Government have not placed any restriction on its use or reproduction.
*
*  Although all reasonable efforts have been taken to ensure the accuracy
*  and reliability of the software and data, the NLM and the U.S.
*  Government do not and cannot warrant the performance or results that
*  may be obtained by using this software or data. The NLM and the U.S.
*  Government disclaim all warranties, express or implied, including
*  warranties of performance, merchantability or fitness for any particular
*  purpose.
*
*  Please cite the author in any work or product based on this material.
*
* ===========================================================================
*
*/

/*==========================================================================
 * NCBI 454 Sequence Read Archive schema
 */
version 1;

include 'ncbi/sra.vschema';
include 'ncbi/spotname.vschema';
include 'ncbi/clip.vschema';


/*--------------------------------------------------------------------------
 * functions
 */

/* dynamic_read_desc
 *  uses inputs to determine read type and segmentation
 *
 *  "edit_distance" [ CONST, OPTIONAL ] - a tolerance figure for
 *  linker matching, where 0 requires exact match, 5 is default.
 *
 *  "spot" [ DATA ] - bases for entire spot
 *
 *  "key" [ DATA, CONTROL ] - bases for key sequence. for version 1,
 *  the first base following key is taken as biological start
 *
 *  "linker" [ DATA, CONTROL, OPTIONAL ] - if present, is used to separate
 *  all bases following "key" into mate pair biological reads
 *
 *  returns a trio for each identified read, with read type, start and length
 */
typeset NCBI:SRA:_454_:drdparam_set { ascii, U8, INSDC:2na:packed };
extern function
U32 [ 3 ] NCBI:SRA:_454_:dynamic_read_desc #1 < * U32 edit_distance >
    ( NCBI:SRA:_454_:drdparam_set spot, NCBI:SRA:_454_:drdparam_set key
      * NCBI:SRA:_454_:drdparam_set linker );

const U32 NCBI:SRA:_454_:dyn_read_type  = 0;
const U32 NCBI:SRA:_454_:dyn_read_start = 1;
const U32 NCBI:SRA:_454_:dyn_read_len   = 2;


/* tokenize_spot_name
 *  scans name on input
 *  tokenizes into parts
 */
extern function NCBI:SRA:spot_name_token
    NCBI:SRA:_454_:tokenize_spot_name #1 ( ascii name );


/*--------------------------------------------------------------------------
 * NCBI:SRA:_454_:common
 *  Roche 454 SRA Platform
 *
 * history:
 *  1.0.1 - explictly base upon sra #1.0.1
 *  1.0.2 - bring in clip processing from external table
 *  1.0.3 - base explicitly upon sra #1.0.2, clip #1.0.1
 *  1.0.4 - base explicitly upon sra #1.0.3, clip #1.0.2
 *  1.0.5 - base explicitly upon sra #1.0.4
 */
table NCBI:SRA:_454_:common #1.0.5 = INSDC:SRA:tbl:sra #1.0.4, NCBI:SRA:tbl:clip #1.0.2
{
    /* PLATFORM
     *  platform name is always 454
     */
    ascii platform_name
        = < ascii > echo < "454" > ();

    /* 454 TECHNICAL SEQUENCES
     */
    column INSDC:dna:text FLOW_CHARS = out_flow_chars;
    INSDC:dna:text in_flow_chars
        = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( FLOW_CHARS );
    column INSDC:dna:text KEY_SEQUENCE = out_key_sequence;
    INSDC:dna:text in_key_sequence
        = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( KEY_SEQUENCE );
    column INSDC:dna:text LINKER_SEQUENCE = out_linker_sequence;
    INSDC:dna:text in_linker_sequence
        = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( LINKER_SEQUENCE );

    // binary technical sequences
    INSDC:x2na:bin out_flow_bin
        = < INSDC:dna:text, INSDC:x2na:bin > map < INSDC:x2na:map:CHARSET, INSDC:x2na:map:BINSET > ( out_flow_chars );
    INSDC:x2na:bin out_key_bin
        = < INSDC:dna:text, INSDC:x2na:bin > map < INSDC:x2na:map:CHARSET, INSDC:x2na:map:BINSET > ( out_key_sequence );
    INSDC:x2na:bin out_linker_bin
        = < INSDC:dna:text, INSDC:x2na:bin > map < INSDC:x2na:map:CHARSET, INSDC:x2na:map:BINSET > ( out_linker_sequence );

    /* SIGNAL
     *  single channel integer
     */
    column NCBI:isamp1 SIGNAL = out_signal;
    NCBI:isamp1 out_signal = .SIGNAL;


	/* INSDC:tbl:sequence inherited productions
	 *  cs_native
	 *  out_cs_key
	 *  in_dna_text
	 *  out_2cs_bin
	 *  out_2na_bin
	 *  out_4na_bin
	 *  out_dna_text
	 *  out_x2cs_bin
	 *  out_x2na_bin
	 *  out_2cs_packed
	 *  out_2na_packed
	 *  out_4na_packed
	 *  out_color_text
	 *  out_qual_phred
	 *  out_color_matrix
	 */

	/* INSDC:SRA:tbl:spotname inherited productions
	 *  out_x_coord
	 *  out_y_coord
	 *  out_name_fmt
	 *  out_spot_name
	 *  spot_ids_found
	 */

	/* INSDC:SRA:tbl:spotdesc inherited productions
	 *  trim_len
	 *  out_label
	 *  out_nreads
	 *  trim_start
	 *  out_read_len
	 *  out_label_len
	 *  out_rd_filter
	 *  out_read_type
	 *  out_read_start
	 *  out_label_start
	 *  static_fixed_spot_len
	 */

	/* INSDC:SRA:tbl:stats inherited productions
	 *  base_count
	 *  spot_count
	 *  max_spot_id
	 *  min_spot_id
	 *  in_stats_bin
	 *  bio_base_count
	 */

	/* NCBI:tbl:n_encoding inherited productions
	 *  read_unpack
	 */

	/* NCBI:SRA:_454_:common productions
	 *  .SIGNAL
	 *  .CLIP_ADAPTER_LEFT
	 *  .CLIP_QUALITY_LEFT
	 *  .CLIP_ADAPTER_RIGHT
	 *  .CLIP_QUALITY_RIGHT
	 *  out_flow_chars
	 *  out_key_sequence
	 *  out_linker_sequence
	 */
};


/*--------------------------------------------------------------------------
 * NCBI:SRA:_454_:tbl:v2
 *  Roche 454 SRA Platform
 *
 * history:
 *  1.0.1 - explictly base upon sra #1.0.1 and related changes
 *  1.0.2 - respond to change to 454:common base table #1.0.2
 */

// encodings are declared to have their own version
// so that they may be changed over time independently
physical INSDC:coord:one NCBI:SRA:_454_:encoding:CLIP #2
{
    decode { return ( INSDC:coord:one ) iunzip ( @ ); }
    encode { return izip ( @ ); }
}

physical NCBI:isamp1 NCBI:SRA:_454_:encoding:SIGNAL #2
{
    decode { return ( NCBI:isamp1 ) iunzip ( @ ); }
    encode { return izip ( @ ); }
}

physical INSDC:position:one NCBI:SRA:_454_:encoding:POSITION #2
{
    decode
    {
        I32 pos_1st_deriv = iunzip ( @ );
        return ( INSDC:position:one ) < I32 > integral ( pos_1st_deriv );
    }
    encode
    {
        I32 pos_1st_deriv = < I32 > deriv ( @ );
        return izip ( pos_1st_deriv );
    }
}

/* normalized v2 table
 *
 * history:
 *  1.0.6 - base upon updated ancestry
 *  1.0.7 - base upon updated ancestry
 *  1.0.8 - base upon sra_nopos #2.1.4, common #1.0.5
 *  2.0.0 - NCBI:tbl:base_space uses metadata RNA_Flag to support RNA reads
 */
table NCBI:SRA:_454_:tbl:v2 #2
    = NCBI:SRA:tbl:sra_nopos #2.1.4
    , NCBI:tbl:base_space #3
    , NCBI:tbl:phred_quality #2.0.3
    , NCBI:SRA:_454_:common #1.0.5
{
    /* NAME tokenizing and coordinates
     *  most work happens in skeyname table
     *  we still obtain REGION from name
     */
    readonly column INSDC:coord:val REGION = ( INSDC:coord:val )
        NCBI:SRA:extract_name_coord < NCBI:SRA:name_token:T > ( _out_name, out_spot_name_tok );
    NCBI:SRA:spot_name_token out_spot_name_tok
        = NCBI:SRA:_454_:tokenize_spot_name ( _out_name );

    NCBI:SRA:spot_name_token in_spot_name_tok
        = NCBI:SRA:_454_:tokenize_spot_name ( NAME );

    // special sequences
    INSDC:dna:text out_flow_chars
        = .FLOW_CHARS
        | < INSDC:dna:text > echo < 'TACG' > ( .SIGNAL )
        | < INSDC:dna:text > echo < 'TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG' > ();

    physical column < INSDC:dna:text > zip_encoding
        .FLOW_CHARS = in_flow_chars;

    INSDC:dna:text out_key_sequence
        = .KEY_SEQUENCE
        | < INSDC:dna:text > echo < 'TCAG' > ();

    physical column < INSDC:dna:text > zip_encoding
        .KEY_SEQUENCE = in_key_sequence;

    INSDC:dna:text out_linker_sequence = .LINKER_SEQUENCE;
    physical column < INSDC:dna:text > zip_encoding
        .LINKER_SEQUENCE = in_linker_sequence;

// linker needs to be representable by its own table
// either in metadata or somewhere else

    // position stored as normal 1-based coordinate
    INSDC:position:one out_position = .POSITION;
    physical column NCBI:SRA:_454_:encoding:POSITION #2
        .POSITION = POSITION;

    // clips
    physical column NCBI:SRA:_454_:encoding:CLIP #2
        .CLIP_ADAPTER_LEFT = CLIP_ADAPTER_LEFT;
    physical column NCBI:SRA:_454_:encoding:CLIP #2
        .CLIP_ADAPTER_RIGHT = CLIP_ADAPTER_RIGHT;
    physical column NCBI:SRA:_454_:encoding:CLIP #2
        .CLIP_QUALITY_LEFT = CLIP_QUALITY_LEFT;
    physical column NCBI:SRA:_454_:encoding:CLIP #2
        .CLIP_QUALITY_RIGHT = CLIP_QUALITY_RIGHT;

    // signal
    physical column NCBI:SRA:_454_:encoding:SIGNAL #2
        .SIGNAL = SIGNAL;
};
