/*===========================================================================
*
*                            PUBLIC DOMAIN NOTICE
*               National Center for Biotechnology Information
*
*  This software/database is a "United States Government Work" under the
*  terms of the United States Copyright Act.  It was written as part of
*  the author's official duties as a United States Government employee and
*  thus cannot be copyrighted.  This software/database is freely available
*  to the public for use. The National Library of Medicine and the U.S.
*  Government have not placed any restriction on its use or reproduction.
*
*  Although all reasonable efforts have been taken to ensure the accuracy
*  and reliability of the software and data, the NLM and the U.S.
*  Government do not and cannot warrant the performance or results that
*  may be obtained by using this software or data. The NLM and the U.S.
*  Government disclaim all warranties, express or implied, including
*  warranties of performance, merchantability or fitness for any particular
*  purpose.
*
*  Please cite the author in any work or product based on this material.
*
* ===========================================================================
*
*/

version 1;

include 'vdb/vdb.vschema';
include 'ncbi/sra.vschema';
include 'ncbi/seq.vschema';
include 'ncbi/stats.vschema';
include 'insdc/insdc.vschema';
include 'insdc/sra.vschema';
include 'ncbi/clip.vschema';
include 'sra/454.vschema';

typedef U16 NCBI:usamp1;
typedef NCBI:usamp1 NCBI:usamp4 [ 4 ];

physical NCBI:usamp4 NCBI:usamp4_encoding #1.0
{
    encode
    {
        // split into 4 separate streams
        NCBI:usamp1 ch0 = < NCBI:usamp1 > cut #1 < 0 > ( @ );
        NCBI:usamp1 ch1 = < NCBI:usamp1 > cut #1 < 1 > ( @ );
        NCBI:usamp1 ch2 = < NCBI:usamp1 > cut #1 < 2 > ( @ );
        NCBI:usamp1 ch3 = < NCBI:usamp1 > cut #1 < 3 > ( @ );

	I32 ich0 = cast ( ch0 );
	I32 ich1 = cast ( ch1 );
	I32 ich2 = cast ( ch2 );
	I32 ich3 = cast ( ch3 );

	I32 ch0d1 = < I32 > deriv ( ich0 );
	I32 ch1d1 = < I32 > deriv ( ich1 );
	I32 ch2d1 = < I32 > deriv ( ich2 );
	I32 ch3d1 = < I32 > deriv ( ich3 );

        // compress each stream separately
        izip_fmt cmp0 = izip ( ch0d1 );
        izip_fmt cmp1 = izip ( ch1d1 );
        izip_fmt cmp2 = izip ( ch2d1 );
        izip_fmt cmp3 = izip ( ch3d1 );

        // merge them into a single blob
        return merge #1 ( cmp0, cmp1, cmp2, cmp3 );
    }

    decode
    {
        // split compressed blob into 4 pieces
        izip_fmt cmp0 = split < 0 > ( @ );
        izip_fmt cmp1 = split < 1 > ( @ );
        izip_fmt cmp2 = split < 2 > ( @ );
        izip_fmt cmp3 = split < 3 > ( @ );

        // decompress each piece separately
        I32 ch0d1 = iunzip ( cmp0 );
        I32 ch1d1 = iunzip ( cmp1 );
        I32 ch2d1 = iunzip ( cmp2 );
        I32 ch3d1 = iunzip ( cmp3 );

	I32 ich0 = < I32 > integral ( ch0d1 );
	I32 ich1 = < I32 > integral ( ch1d1 );
	I32 ich2 = < I32 > integral ( ch2d1 );
	I32 ich3 = < I32 > integral ( ch3d1 );

	U16 ch0 = cast ( ich0 );
	U16 ch1 = cast ( ich1 );
	U16 ch2 = cast ( ich2 );
	U16 ch3 = cast ( ich3 );

        // interleave into single stream
        return ( NCBI:usamp4 ) < U16 > paste #1 ( ch0, ch1, ch2, ch3 );
    }
}

table NCBI:sra:tbl:trace #1                     // declare the table
    = NCBI:SRA:tbl:sra_nopos #2.1.4             // inherit interface AND implementation for (original) SRA model
    , NCBI:tbl:base_space #3                    // columns for storing and compressing READ as dna
    , NCBI:tbl:phred_quality #2.0.6             // columns for storing and compressing QUALITY as phred
    , NCBI:SRA:tbl:stats #1.2.1                 // accumulate statistics upon writing
    , NCBI:SRA:tbl:clip #1.0.2                  // clips 
{
    /* PLATFORM
     *  platform name is generically called "capillary"
     */
    ascii platform_name
        = < ascii > echo < "CAPILLARY" > ();

    /*
    // NEEDED:
    //  out_signal   (i.e. trace)
    //  trim_len
    //  trim_start
    //  out_spot_group
    //  in_spot_name_tok
    //  out_position (i.e. peak)
    */

    // *
    // position
    // position stored as normal 1-based coordinate
    INSDC:position:one out_position = .POSITION;
    physical column NCBI:SRA:_454_:encoding:POSITION #2
        .POSITION = POSITION;

    // *
    // clip_quality_left
    physical column < INSDC:coord:one > izip_encoding
        .CLIP_QUALITY_LEFT = CLIP_QUALITY_LEFT;

    // *
    // clip_quality_right
    physical column < INSDC:coord:one > izip_encoding
        .CLIP_QUALITY_RIGHT = CLIP_QUALITY_RIGHT;

    // *
    // clip_vector_left
    extern column < U32 > izip_encoding CLIP_VECTOR_LEFT;

    // *
    // clip_vector_right
    extern column < U32 > izip_encoding CLIP_VECTOR_RIGHT;

    // *
    // trace_name
    //  name of the submission.
    extern column ascii TRACE_NAME = out_trace_name;
    ascii in_trace_name = TRACE_NAME;
    physical column < ascii > zip_encoding .TRACE_NAME = in_trace_name;
    ascii out_trace_name = .TRACE_NAME;

    // *
    // ti
    extern column < U64 > izip_encoding TI;
    readonly column U32 ti = cast ( TI );

    // *
    // replaced_by
    extern column < U64 > izip_encoding REPLACED_BY;
    readonly column U32 replaced_by = cast ( REPLACED_BY );

    // *
    // submission_id
    // Field is dictionary from SubmissionType
    // U16 -> ASCII. Has 15 names like: NEWTRACELESS, TRACELESS, etc
    // Should be canonized
    extern column < ascii > zip_encoding SUBMISSION_ID;

    // *
    // submission_type
    extern column < ascii > zip_encoding SUBMISSION_TYPE;

    // *
    // chip_design_id
    // Was added, cuz that value could be added
    // Mirrored feature_id_file_name
    extern column < ascii > zip_encoding CHIP_DESIGN_ID;

    // *
    // center_name
    // Field is dictionary from Center
    // U16 -> ASCII. Has 184 names like: 454MSC, ABC, ABI, AGI, etc
    extern column < ascii > zip_encoding CENTER_NAME;

    // *
    // trace_max_value
    extern column < U16 > izip_encoding TRACE_MAX_VALUE;

    // *
    // trace_format
    // Field is dictionary from Format
    // U16 -> ASCII. Has 5 values: SCF, ZTR, AB1, ABI, SFF
    extern column < ascii > zip_encoding TRACE_FORMAT;

    // *
    // source_type
    // Field is dictionary from Source
    // U8 -> ASCII. Has 7 values: G, GENOMIC, N, NON GENOMIC, S,
    //                            SYNTHETIC, VIRAL RNA
    extern column < ascii > zip_encoding SOURCE_TYPE;

    // *
    // trace_direction
    // Field is dictionary from Direction
    // U8 -> ASCII. Has 6 values: F, FORWARD, N, R, REVERSE, UNKNOWN
    extern column < ascii > zip_encoding TRACE_DIRECTION;

    // *
    // trace_end
    // Field is dictionary from EndId
    // U8 -> ASCII. Has 6 values: F, FORWARD, N, R, REVERSE, UNKNOWN
    extern column < ascii > zip_encoding TRACE_END;

    // *
    // primer
    extern column < ascii > zip_encoding PRIMER;

    // *
    // strategy
    // Field is dictionary from Strategy (?) ( wrong size )
    // U8 -> ASCII. Has 38 values like: AFLP, BARCODE, CCS, CDNA, etc
    extern column < ascii > zip_encoding STRATEGY;

    // *
    // trace_type_code
    // Field is dictionary from  BlastDump (?)
    // There are 17 tinyints like: FINISHING, RANDOM, WGS, etc
    extern column < ascii > zip_encoding TRACE_TYPE_CODE;

    // *
    // program_id
    // Field is dictionary from Program
    // U16 -> ASCII
    // There are 1193 values, which looks quite unique, no decriptions
    extern column < ascii > zip_encoding PROGRAM_ID;

    // *
    // template_id
    extern column < ascii > zip_encoding TEMPLATE_ID;

    // *
    // chemistry
    // Field is dictionary from Chemistry
    // U16 -> ASCII. Has 60 values, and one of them with id = 4 is ""
    extern column < ascii > zip_encoding CHEMISTRY;

    // *
    // chemistry_type
    // Field is dictionary from ChemistryType
    // U16 -> ASCII
    // Has 3 chemistry types, and 6 names:
    // 1 { T, TERM, TERMINATOR }, 2 { UNKNOWN }, 3 { P, PRIMER }
    extern column < ascii > zip_encoding CHEMISTRY_TYPE;

    // *
    // flow_chars
    column INSDC:dna:text FLOW_CHARS = out_flow_chars;
    INSDC:dna:text in_flow_chars
        = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( FLOW_CHARS );
    physical column < INSDC:dna:text > zip_encoding
        .FLOW_CHARS = in_flow_chars;
    INSDC:dna:text out_flow_chars
        = .FLOW_CHARS;                                                                                                      

    // *
    // key_sequence
    column INSDC:dna:text KEY_SEQUENCE = out_key_sequence;
    INSDC:dna:text in_key_sequence
        = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( KEY_SEQUENCE );
    physical column < INSDC:dna:text > zip_encoding
        .KEY_SEQUENCE = in_key_sequence;
    INSDC:dna:text out_key_sequence
        = .KEY_SEQUENCE;                   

    // *
    // signal - actual TRACE data
    column NCBI:usamp4_encoding SIGNAL;
    //column NCBI:usamp4 SIGNAL;
    NCBI:usamp4 out_signal = .SIGNAL;

    // *
    // attempt
    extern column < U8 > zip_encoding ATTEMPT;

    // *
    // svector_code
    // Field is dictionary from SeqVector
    // U16 -> ASCII. Has 230 values like: POT, M13, PUC, POTW13, etc
    extern column < ascii > zip_encoding SVECTOR_CODE;

    // *
    // svector_accession
    // Field is dictionary from SeqVectorAcc
    // U16 -> ASCII. Has 8 values like: AF399742, L08752, etc
    extern column < ascii > zip_encoding SVECTOR_ACCESSION;

    // *
    // cvector_code
    // Field is dictionary from CloneVector
    // U16 -> ASCII. Has 125 values like: PBACE3.6, PT7T3PAC, PPAC4, etc
    extern column < ascii > zip_encoding CVECTOR_CODE;

    // *
    // cvector_accession
    // Field is dictionary from CloneVectorAcc
    // U16 -> ASCII. Has 16 values like: U80929, U13871, U75992, etc
    extern column < ascii > zip_encoding CVECTOR_ACCESSION;

    // *
    // insert_size
    extern column < U32 > izip_encoding INSERT_SIZE;

    // *
    // insert_stdev
    extern column < U32 > izip_encoding INSERT_STDEV;

    // *
    // iteration - it did exists some tiome ago
    extern column < U16 > izip_encoding ITERATION;

    // *
    // plate_id
    // Field is dictionary from Plate
    // U32 -> ASCII. Has 7M values like: ML1B-A1156, ML1B-A1158, etc
    extern column < ascii > zip_encoding PLATE_ID;

    // *
    // species_code
    // Field is dictionary from Species
    // U32 -> ASCII. Has 12K values like: "ARTIFICIAL SEQUENCE",
    // "SYNTHETIC", "SYNTHETIC CONSTRUCT", etc
    extern column < ascii > zip_encoding SPECIES_CODE;

    // *
    // organism_name_OLD
    extern column < ascii > zip_encoding ORGANISM_NAME_OLD;

    // *
    // clone_id
    extern column < ascii > zip_encoding CLONE_ID;

    // *
    // chromosome
    // Field is dictionary from Chromosome
    // U8 -> ASCII. Has 171 value like: NA, 11, 7, 12, 14, etc
    extern column < ascii > zip_encoding CHROMOSOME;

    // *
    // library_id
    // Field is dictionary from Library
    // U16 -> ASCII. Has 11K values like: CH230, RP1, RP11, etc
    extern column < ascii > zip_encoding LIBRARY_ID;

    // *
    // accession
    extern column < ascii > zip_encoding ACCESSION;

    // *
    // run_machine_id
    // Field is dictionary from Machine
    // U16 -> ASCII. Has 2K values like: 194, 137, 130, 300, etc
    extern column < ascii > zip_encoding RUN_MACHINE_ID;

    // *
    // run_machine_type
    // Field is dictionary from MachineType
    // U16 -> ASCII. Has 160 values like: 194, 137, 130, 300, etc
    extern column < ascii > zip_encoding RUN_MACHINE_TYPE;

    // *
    // run_lane
    extern column < U16 > izip_encoding RUN_LANE;

    // *
    // run_date
    // smalldatetime
    extern column < U64 > izip_encoding RUN_DATE;

    // *
    // load_date
    // smalldatetime
    extern column < U64 > izip_encoding LOAD_DATE;

    // *
    // control_flags
    extern column < U16 > izip_encoding CONTROL_FLAGS;

    // *
    // status
    extern column < U8 > izip_encoding STATUS;

    // *
    // seq_lib_id
    // Field is dictionary from SeqLibrary
    // U32 -> ASCII. Has 700K values like: 33802, RATBN2.5.2L, etc
    extern column < ascii > zip_encoding SEQ_LIB_ID;

    // *
    // run_group_id
    // Field is dictionary from RunGroup
    // U32 -> ASCII. Has 5M values like: 2000-01-24-GEA-D, etc
    extern column < ascii > zip_encoding RUN_GROUP_ID;

    // *
    // update_date
    // smalldatetime
    extern column < U64 > izip_encoding UPDATE_DATE;

    // *
    // clone_id_list
    extern column < ascii > zip_encoding CLONE_ID_LIST;

    // *
    // extended_data
    extern column < ascii > zip_encoding EXTENDED_DATA;

    // *
    // comments
    extern column < ascii > zip_encoding COMMENTS;

    // *
    // center_project
    // Field is dictionary from Project
    // U32 -> ASCII. Has 2M values like: 30153, 31491, 31489, etc
    extern column < ascii > zip_encoding CENTER_PROJECT;

    // *
    // prep_group_id
    // Field is dictionary from PrepGroup
    // U32 -> ASCII. Has 3M values like: 6AUG03.842PMAB1, etc
    extern column < ascii > zip_encoding PREP_GROUP_ID;

    // *
    // pmid
    extern column < U32 > izip_encoding PMID;

    // *
    // pick_group_id
    // Field is dictionary from PickGroup
    // U32 -> ASCII. Has 1.5M values like: 893877, 895133, etc
    extern column < ascii > zip_encoding PICK_GROUP_ID;

    // *
    // bases_20
    extern column < U16 > izip_encoding BASES_20;

    // *
    // bases_40
    extern column < U16 > izip_encoding BASES_40;

    // *
    // bases_60
    extern column < U16 > izip_encoding BASES_60;

    // *
    // strain
    // Field is dictionary from Strain
    // U32 -> ASCII. Has 1.2K values like: KT, SRS30216, LB400, etc
    extern column < ascii > zip_encoding STRAIN;

    // *
    // amplification_forward
    // Field is dictionary from AmplificationForward
    // U32 -> ASCII. Has 400K values like: GACGACGAAGACGAAGAAGG, etc
    extern column < ascii > zip_encoding AMPLIFICATION_FORWARD;

    // *
    // amplification_reverse
    // Field is dictionary from AmplificationReverse
    // U32 -> ASCII. Has 400K values like: AACTCGCTCCAATGAGGAAA, etc
    extern column < ascii > zip_encoding AMPLIFICATION_REVERSE;

    // *
    // amplification_size
    extern column < U32 > izip_encoding AMPLIFICATION_SIZE;

    // *
    // assembly_id
    // Field is dictionary from AssemblyId
    // U32 -> ASCII. Has 2 values: "NCBI BUILD 34", and
    // "HUMAN BUILD 33, APRIL 2003 FREEZE".
    extern column < ascii > zip_encoding ASSEMBLY_ID;

    // *
    // chromosome_region
    // Field is dictionary from ChromosomeRegion
    // U32 -> ASCII. Has 5K values like: "7:26665793-2716579226"
    extern column < ascii > zip_encoding CHROMOSOME_REGION;

    // *
    // hi_filter_size
    // Field is dictionary from HiFilterSize
    // U32 -> ASCII. Has 6 values like: "0.1 KD-MICRONS", "0.22", etc
    extern column < ascii > zip_encoding HI_FILTER_SIZE;

    // *
    // lo_filter_size
    // Field is dictionary from LoFilterSize
    // U32 -> ASCII. Has 7 values like: "0.0 MICRONS", "0.002", etc
    extern column < ascii > zip_encoding LO_FILTER_SIZE;

    // *
    // environment_type
    // Field is dictionary from EnvironmentType
    // U32 -> ASCII. Has 52 values like: "BEACH SAND",
    // "HUMAN STOOL", "NORTH ATLANTIC DEEP WATER", etc
    extern column < ascii > zip_encoding ENVIRONMENT_TYPE;

    // *
    // host_condition
    // Field is dictionary from HostCondition
    // U32 -> ASCII. Has only one value: "HEALTHY"
    extern column < ascii > zip_encoding HOST_CONDITION;

    // *
    // host_id
    // Field is dictionary from HostIdentifier
    // U32 -> ASCII. Has 69 values like: 01DBA0010, 01DBA0011, etc
    extern column < ascii > zip_encoding HOST_ID;

    // *
    // host_location
    // Field is dictionary from HostLocation
    // U32 -> ASCII. Contains 30 values like: "BELOW CUTICLE", "BONE",
    // "CECUM", "CORPUS", etc
    extern column < ascii > zip_encoding HOST_LOCATION;

    // *
    // host_species
    // Field is dictionary from HostSpecies
    // U32 -> ASCII. Has 11 values like: "ALVINELA POMPEJANA EPIBIONT"
    // "ESCHRICHTIUS ROBUSTUS", "HOMO NEANDERTHALENSIS", etc
    extern column < ascii > zip_encoding HOST_SPECIES;

    // *
    // individual_id
    // Field is dictionary from IndividualId
    // U32 -> ASCII. Has 3M values like: "JDH LADY MANSO 62/4",
    // "WA-DEL RC BLCKSTR MARTHA-ET (HO-USA 13907649)", etc
    extern column < ascii > zip_encoding INDIVIDUAL_ID;

    // *
    // transposon_acc
    // Field is dictionary from TransposonAcc
    // U32 -> ASCII. Has 4 values: "N/A", "NGB00024.2", "", "BD291493"
    extern column < ascii > zip_encoding TRANSPOSON_ACC;

    // *
    // transposon_code
    // Field is dictionary from TransposonCode
    // U32 -> ASCII. Has 8 values like: AT-2, EZ-TN, EZ-TN5, etc
    extern column < ascii > zip_encoding TRANSPOSON_CODE;

    // *
    // collection_date
    // smalldatetime
    extern column < U64 > izip_encoding COLLECTION_DATE;

    // *
    // depth
    extern column F64 DEPTH;

    // *
    // elevation
    extern column F64 ELEVATION;

    // *
    // latitude
    extern column F64 LATITUDE;

    // *
    // longitude
    extern column F64 LONGITUDE;

    // *
    // ph
    extern column F64 PH;

    // *
    // salinity
    extern column F64 SALINITY;

    // *
    // temperature
    extern column F64 TEMPERATURE;

    // *
    // population_id
    // Field is dictionary from Population
    // U32 -> ASCII. Has 10 values like: "AFRICAN", "CAUCASIAN", etc
    extern column < ascii > zip_encoding POPULATION_ID;

    // *
    // place_name
    // Field is dictionary from PlaceName
    // U32 -> ASCII. Has 82 values like: "HYDROSTATION S, BERMUDA (UK)"
    extern column < ascii > zip_encoding PLACE_NAME;

    // *
    // well_id
    // Field is dictionary from Well
    // U32 -> ASCII. Has 300K values like: C6, G9, H2, B5, C11, etc
    extern column < ascii > zip_encoding WELL_ID;

    // *
    // gene_name
    // Field is dictionary from GeneName
    // U32 -> ASCII. Has 30K values like: COI, HIF1A, PRKCB1, etc
    extern column < ascii > zip_encoding GENE_NAME;

    // *
    // reference_accession
    // Field is dictionary from ReferenceAccession
    // U32 -> ASCII. Has 6K names like: NT_039520.1, NT_039268.1, etc
    extern column < ascii > zip_encoding REFERENCE_ACCESSION;

    // *
    // reference_offset
    extern column < U32 > izip_encoding REFERENCE_OFFSET;

    // *
    // insert_flank_left
    // Field is dictionary from InsertFlankLeft
    // U32 -> ASCII. Has 266 values like: AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCCCAC", etc
    extern column < ascii > zip_encoding INSERT_FLANK_LEFT;

    // *
    // insert_flank_right
    // Field is dictionary from InsertFlankRight
    // U32 -> ASCII. Has 221 values like: GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTAT, etc
    extern column < ascii > zip_encoding INSERT_FLANK_RIGHT;

    // *
    // reference_acc_min
    extern column < U32 > izip_encoding REFERENCE_ACC_MIN;

    // *
    // reference_acc_max
    extern column < U32 > izip_encoding REFERENCE_ACC_MAX;

    // *
    // feature_id_file_name
    // Field is dictionary from FeatureIdFile
    // U32 -> ASCII. Has 4k values like: PSC.CHRN_077.DES33, etc
    extern column < ascii > zip_encoding FEATURE_ID_FILE_NAME;

    // *
    // feature_signal_file_name
    // Field is dictionary from FeatureSignalFile
    // U32 -> ASCII. Has only one value: N/A ... lol
    extern column < ascii > zip_encoding FEATURE_SIGNAL_FILE_NAME;

    // *
    // ncbi_project_id
    // Field is dictionary from ProjectContent
    // U32 - as is ... there are 188 values
    extern column < U32 > izip_encoding NCBI_PROJECT_ID;

    // *
    // project_name
    // Field is dictionary from ProjectName
    // U32 -> ASCII. Has 29 values like: "ARALL", "BARCODE", etc
    extern column < ascii > zip_encoding PROJECT_NAME;

    // *
    // primer_code
    // Field is dictionary from PrimerCode
    // U32 -> ASCII. Has 95K values like: "M13 FORWARD", etc
    extern column < ascii > zip_encoding PRIMER_CODE;

    // *
    // taxid
    // Field is dictionary from TaxonomyTree
    // U32 -> ASCII. Has 4K values like: "Bacteria", "Pelobacter", etc
    extern column < ascii > zip_encoding TAXID;

    // *
    // anonymized_id
    // Field is dictionary from AnonymizedId
    // U32 -> ASCII. Has 15M values like: 10685146475, 10690251308, etc
    extern column < ascii > zip_encoding ANONYMIZED_ID;

    // *
    // reference_set_max
    extern column < U32 > izip_encoding REFERENCE_SET_MAX;

    // *
    // reference_set_min
    extern column < U32 > izip_encoding REFERENCE_SET_MIN;

    // *
    // organism_name
    // Field is dictionary from OrganismName
    // U32 -> ASCII. Has 170K names like: "THUNNUS ATLANTICUS", etc
    extern column < ascii > zip_encoding ORGANISM_NAME;

	/* INSDC:tbl:sequence inherited virtual productions
	 *  bool cs_native;
	 *  virtual in_cs_key = 0;
	 *  INSDC:dna:text out_cs_key;
	 *  virtual out_signal = 0;                ##
	 *  INSDC:dna:text in_dna_text;
	 *  INSDC:2cs:bin out_2cs_bin;
	 *  INSDC:2na:bin out_2na_bin;
	 *  INSDC:4na:bin out_4na_bin;
	 *  INSDC:dna:text out_dna_text;
	 *  INSDC:x2cs:bin out_x2cs_bin;
	 *  INSDC:x2na:bin out_x2na_bin;
	 *  virtual in_color_text = 0;
	 *  INSDC:2cs:packed out_2cs_packed;
	 *  INSDC:2na:packed out_2na_packed;
	 *  INSDC:4na:packed out_4na_packed;
	 *  INSDC:color:text out_color_text;
	 *  INSDC:quality:phred out_qual_phred;
	 *  U8 out_color_matrix;
	 *  virtual out_qual_text_phred_33 = 0;
	 *  virtual out_qual_text_phred_64 = 0;
	 */

	/* INSDC:SRA:tbl:spotcoord inherited virtual productions
	 *  INSDC:coord:val out_x_coord;
	 *  INSDC:coord:val out_y_coord;
	 */

	/* INSDC:SRA:tbl:spotname inherited virtual productions
	 *  ascii out_name_fmt;
	 *  ascii out_spot_name;
	 *  INSDC:SRA:spot_ids_found spot_ids_found;
	 */

	/* INSDC:SRA:tbl:spotdesc inherited virtual productions
	 *  virtual trim_len = 0;                   ##
	 *  ascii out_label;
	 *  U8 out_nreads;
	 *  virtual trim_start = 0;                 ##
	 *  INSDC:coord:len out_read_len;
	 *  INSDC:coord:len out_label_len;
	 *  INSDC:SRA:read_filter out_rd_filter;
	 *  INSDC:SRA:xread_type out_read_type;
	 *  virtual align_spot_len = 0;
	 *  INSDC:coord:zero out_read_start;
	 *  INSDC:coord:zero out_label_start;
	 *  virtual _alt_in_read_len = 0;
	 *  virtual _alt_in_read_type = 0;
	 *  INSDC:coord:len base_space_spot_len;
	 *  virtual color_space_spot_len = 0;
	 *  virtual static_fixed_spot_len = 0;
	 *  INSDC:coord:len base_space_fixed_spot_len;
	 *  virtual color_space_fixed_spot_len = 0;
	 */

	/* INSDC:SRA:tbl:stats inherited virtual productions
	 *  U64 base_count;
	 *  U64 spot_count;
	 *  INSDC:SRA:spotid_t max_spot_id;
	 *  INSDC:SRA:spotid_t min_spot_id;
	 *  U8 in_stats_bin;
	 *  U64 bio_base_count;
	 *  U64 cmp_base_count;
	 */

	/* INSDC:SRA:tbl:sra inherited virtual productions
	 *  INSDC:SRA:platform_id out_platform;
	 *  ascii platform_name;
	 *  virtual out_spot_group = 0;              ## ?
	 */

	/* NCBI:tbl:dcmp_base_space inherited virtual productions
	 *  virtual out_dcmp_2na_bin = 0;
	 *  virtual out_dcmp_4na_bin = 0;
	 *  virtual out_dcmp_x2na_bin = 0;
	 *  virtual out_dcmp_2na_packed = 0;
	 */

	/* NCBI:tbl:base_space_common inherited virtual productions
	 *  virtual .CS_KEY = 0;
	 */

	/* NCBI:SRA:tbl:spotcoord inherited virtual productions
	 *  virtual in_l_coord = 0;                  ## these could ONLY be needed if
	 *  virtual in_t_coord = 0;                  #  we have coordinates in the name
	 *  virtual in_x_coord = 0;                  #  and if we parse and store the name
	 *  virtual in_y_coord = 0;
	 *  INSDC:coord:val in_name_l_coord;
	 *  INSDC:coord:val in_name_t_coord;
	 *  INSDC:coord:val in_name_x_coord;
	 *  INSDC:coord:val in_name_y_coord;
	 */

	/* NCBI:SRA:tbl:skeyname inherited virtual productions
	 *  virtual in_spot_name_tok = 0;
	 */

	/* NCBI:SRA:tbl:stats inherited virtual productions
	 *  virtual in_spot_len = 0;
	 *  INSDC:quality:phred in_qual_phred;
	 *  INSDC:quality:phred in_stats_qual;
	 *  virtual in_cmp_stats_bin = 0;
	 */

	/* NCBI:SRA:tbl:spotdesc_nocol inherited virtual productions
	 *  virtual out_read_seg = 0;
	 *  virtual out_label_seg = 0;
	 *  U32 [ 2 ] out_read_seg32;
	 *  U32 [ 2 ] out_label_seg32;
	 */

	/* NCBI:SRA:tbl:spotdesc_nophys inherited virtual productions
	 *  physical < ascii > zip_encoding #1 .LABEL;
	 *  physical < U8 > zip_encoding #1 .NREADS;
	 *  physical < INSDC:coord:len > izip_encoding #1 .READ_LEN;
	 *  virtual .READ_SEG = 0;
	 *  physical < INSDC:coord:len > izip_encoding #1 .LABEL_LEN;
	 *  virtual .LABEL_SEG = 0;
	 *  physical < INSDC:SRA:read_filter > zip_encoding #1 .RD_FILTER;
	 *  physical < INSDC:SRA:xread_type > zip_encoding #1 .READ_TYPE;
	 *  physical < INSDC:coord:zero > izip_encoding #1 .READ_START;
	 *  physical < INSDC:coord:zero > izip_encoding #1 .LABEL_START;
	 */

	/* NCBI:SRA:tbl:sra_nopos inherited virtual productions
	 *  virtual out_position = 0;                 ##
	 */
}

database NCBI:sra:db:trace #1
{
    table NCBI:sra:tbl:trace #1 SEQUENCE;
}